If you have been reading about actin-binding motif and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2026-06-08. Where a claim depends on a specific study, the study is described rather than over-claimed.
Thymosin beta-4 itself is a small, widely expressed protein that sequesters monomeric actin and participates in cell migration, angiogenesis, and tissue repair. Researchers have examined the shortened fragment as a possible mimic of some of these activities, reasoning that the actin-binding motif lies within the first few residues. Binding to monomeric actin has been observed in cell-free systems. Whether the fragment reproduces the broader effects of the full protein in living tissue remains an open question, and findings from animal models are frequently cited without a clear bridge to human physiology.
Discussion of TB-500 appears in several distinct literatures that rarely cite one another. Peer-reviewed studies usually describe in vitro assays or small animal experiments and are cautious about extrapolation. Veterinary and sports communities circulate anecdotal reports with limited methodological detail. Commercial listings add a third layer, often using the name interchangeably with thymosin beta-4 even though the two molecules differ in size and sequence. Regulatory status varies by country, and the compound is not a licensed medicine in most jurisdictions, so readers comparing sources should check which molecule and which purity each source actually describes.
TB-500 is a synthetic seven-residue peptide whose sequence, LKKTETQ, matches the N-terminal actin-binding region of thymosin beta-4. It is usually supplied in an N-terminally acetylated form, a modification that blocks the free amino terminus and can influence behavior in solution. In the research literature the same sequence appears under several names, including thymosin beta-4 fragment and shortened thymosin beta-4. Because it is a short peptide rather than the full 43-residue parent protein, its measured properties differ from those reported for thymosin beta-4 as a whole, and the two are not interchangeable in experimental design.
TB-500 is a laboratory label applied to a short synthetic peptide that is widely described as a fragment of thymosin beta-4, an actin-binding protein present in most mammalian cells. Suppliers and review articles usually present TB-500 as the N-terminal region of that protein, but the exact sequence attached to the name is not consistent across sources. Some product descriptions list a seven-residue chain; others use the label loosely for the parent protein itself. Because of that variation, any technical discussion of TB-500 needs to state which sequence is meant.
Thymosin beta-4 contains 43 amino acids and has a reported molecular mass near 4963 Da. The short fragment most often associated with the TB-500 label, an acetylated chain beginning LKKTETQ, has a reported mass near 889 Da, so the two are easily separated in analytical work. Mass spectrometry and amino acid analysis can confirm which material is present in a given sample. Statements treating TB-500 and thymosin beta-4 as interchangeable are therefore imprecise, even though the two appear together in much of the same literature.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide | N-terminal fragment of thymosin beta-4 |
| Residue count | Seven | Sequence LKKTETQ |
| Approximate mass | 889 Da | Acetylated seven-residue peptide |
| Common synonyms | TB4 fragment, TB500 | Not identical to full-length TB4 |
| Reported activity | Actin binding | Observed mainly in cell-free systems |
Full-length thymosin beta-4 consists of roughly forty-three amino acids and ranks among the more abundant small proteins in the cytoplasm. The fragment is much shorter, so it cannot reproduce every function attributed to the intact molecule. In cell culture, short actin-binding motifs can interfere with filament dynamics and cell movement, but such observations come from controlled experiments rather than from whole-animal work. Whether a truncated fragment produces the same effects as the parent protein remains an open question.
Interest in the peptide grew during the 2000s and 2010s, when studies of tendon and ligament injuries in horses reported changes in lesion size after treatment. Those reports circulated widely outside the scientific literature and shaped much of the current online discussion. Subsequent reviews noted inconsistent study design, small groups, and a shortage of independent replication. Popular descriptions often blur the line between the fragment, the complete protein, and unrelated growth factors, which complicates comparisons across sources.
TB-500 is a synthetic peptide whose sequence corresponds to a short fragment near the N-terminus of thymosin beta-4, a small protein present in most mammalian cells. The fragment is commonly cited as containing the actin-binding region of the parent molecule, which is why it appears in laboratory work on cell migration and tissue repair. Suppliers distribute it as a lyophilised powder intended for research use. Its identity is defined by amino acid sequence and by the presence of an acetyl group on the N-terminal residue.
TB-500 is a research peptide whose sequence matches residues 17 to 23 of thymosin beta-4, a 43-residue protein present in most mammalian cells. The chain is seven amino acids long, written as LKKTETQ, and is normally supplied with an acetyl group on the N-terminus. Suppliers list it as a lyophilised powder under the code name TB-500, and the same sequence appears elsewhere in catalogues as the thymosin beta-4 actin-binding fragment. The label is commercial rather than systematic, so no single authority fixes exactly what TB-500 denotes.
Thymosin beta-4 was isolated from calf thymus in the early 1980s and later characterised as an abundant intracellular actin-sequestering protein. Interest in short synthetic fragments grew once the actin-binding motif had been mapped to the middle of the sequence. TB-500 came out of that line of work as a truncated analogue rather than a natural isolate, and it is now sold mainly to laboratories. Published studies on the fragment have been largely in vitro or in animal models, and controlled human trials remain sparse, so claims about effects in people rest on extrapolation.
Literature and online discussion often conflate TB-500 with full-length thymosin beta-4, even though the two differ in size and are not interchangeable in analytical terms. The fragment is produced by solid-phase peptide synthesis, and the product is a defined seven-residue chain rather than a biological extract. Because the term is a trade-style label, two vendors may supply materials of the same nominal sequence but different counter-ion content, purity, or water content. Comparisons across studies are therefore difficult unless the exact sequence and purity are reported.
Discussion of the compound frequently appears alongside other short peptides described as fragments of larger proteins. That grouping is convenient but can be misleading, because fragment length, charge, and modification state determine how a peptide behaves in solution and in any experimental system. A seven-residue acetylated peptide and a full-length protein differ in mass by roughly an order of magnitude, and they cannot be assumed to share distribution or binding properties. Precision about which molecule is under discussion is the single most useful step when reading such material.
TB-500 is a shorthand label used in supplier catalogs and online discussion for a short synthetic peptide described as a fragment of thymosin beta-4. Most product listings present it as the N-terminally acetylated heptapeptide Ac-LKKTETQ, a sequence corresponding to the actin-binding region of the parent protein. The name is not a formal chemical designation and does not appear in standard nomenclature systems. Because labeling practices vary between vendors, two products sold under the same name may not contain the same molecule, and the stated sequence should be treated as a claim rather than a fixed definition.
Thymosin beta-4 is a naturally occurring protein of 43 amino acids found in most mammalian cells, where it binds actin monomers and influences filament dynamics. It was first isolated from thymus tissue in the early 1980s, and its actin-binding activity was later mapped to a short region near the N-terminus. The synthetic fragment sold as TB-500 was designed to reproduce that region rather than the full protein. Whether a short fragment reproduces the behavior of the intact molecule remains an open question, since the parent protein carries additional structural elements outside the binding region.
Dry peptide powder is commonly kept at −20 °C in a desiccated container away from light, a practice that limits moisture uptake and oxidation. Once dissolved, solutions are generally held at 2–8 °C for short periods or frozen at −20 °C or lower for longer storage, with repeated freeze-thaw cycles avoided. Hydrolysis and oxidation are the main degradation routes for peptides in solution, and both accelerate at higher temperature or extreme pH. Published stability data specific to TB-500 are limited, so shelf life should be treated as uncertain.
Identity and purity checks for peptide material typically combine reversed-phase high-performance liquid chromatography with mass measurement, since retention time alone cannot confirm a sequence. Mass measurement verifies the expected molecular mass within instrument tolerance, while chromatographic peak area provides a purity estimate. Anti-doping analysis of urine uses related but more sensitive workflows, sometimes after solid-phase extraction. For research material, batch documentation, certificate content, and independent testing are common points of scrutiny, because supply chains outside pharmaceutical regulation vary widely in the paperwork they provide.
Cmin is a term used in pharmacokinetics for the minimum blood plasma concentration reached by a drug during a dosing interval, which is the time interval between administration of two doses. This definition is slightly different from Ctrough, the concentration immediately prior to administration of the next dose. Cmin is the opposite of Cmax, the maximum concentration that the drug reaches. Cmin must be above certain thresholds, such as the minimum inhibitory concentration (MIC), to achieve a therapeutic effect. In most cases Cmin is directly measurable. At steady state the minimum plasma concentration can also be calculated using the following equation:
Absorption of cadmium through the lungs is more effective than through the gut. As much as 50% of the cadmium inhaled in cigarette smoke may be absorbed. On average, cadmium concentrations in the blood of smokers is 4 to 5 times greater than non-smokers and in the kidney, 2–3 times greater than in non-smokers. Despite the high cadmium content in cigarette smoke, there seems to be little exposure to cadmium from passive smoking. In a non-smoking population, food accounts for around 90% of cadmium uptake. High quantities of cadmium can be found in crustaceans, mollusks, offal, frog legs, cocoa powder, bitter and semi-bitter chocolate, seaweed, fungi and algae products. However, grains, vegetables, and starchy roots and tubers are consumed in much greater quantity in the U.S., and are the source of the greatest dietary exposure there. Most plants bio-accumulate metal toxins such as cadmium and when composted to form organic fertilizers, yield a product that often can contain high amounts (e.g., over 0.5 mg) of metal toxins for every kilogram of fertilizer. Fertilizers made from animal dung (e.g., cow dung) or urban waste can contain similar amounts of cadmium. The cadmium added to the soil from fertilizers (rock phosphates or organic fertilizers) become bio-available and toxic only if the soil pH is low (i.e., acidic soils). In the European Union, an analysis of almost 22,000 topsoil samples with LUCAS survey concluded that 5.5% of samples have concentrations higher than 1 mg kg−1.
Adnexal mass entry in the public domain NCI Dictionary of Cancer Terms Emedicine overview This article incorporates public domain material from Dictionary of Cancer Terms. U.S. National Cancer Institute.
Sources: en.wikipedia.org
Many pharmaceuticals are derived from petroleum, albeit via multi-step processes. Modern medicine depends on petroleum as a source of building blocks, reagents, and solvents. Similarly, virtually all pesticides, insecticides, and herbicides are derived from petroleum. Pesticides have profoundly affected life expectancies by controlling disease vectors and by increasing crop yield. Like pharmaceuticals, pesticides are in essence petrochemicals. Almost all plastics and synthetic polymers are derived from petroleum, which is the source of monomers. Alkenes (olefins) are one important class of these precursor molecules.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
The first selective CCKB receptor antagonists were modified peptide molecules such as CI-988 and the more metabolically stable CI-1015, however these were disadvantaged by only being able to be administered by injection and rapid breakdown inside the body, which led to a short half-life and limited utility. Non-peptide CCKB receptor antagonists such as L-365,260, L-369,293, YF-476, RP-69758, LY-288,513, PD-145,942 and the CCKB receptor inverse agonist L-740,093 have since been developed, and while all of the drugs developed so far have suffered from limited bioavailability or other issues which have hindered their clinical development, research in this area continues. CCKA receptors are also expressed in the brain to some extent, and IQM-95333, an antagonist selective for this population of CCKA receptors, was also found to reduce anxiety in animal models. Conversely, inhibition of CCKB receptors in the gut produces similar inhibition of secretion of gastric acid and pepsinogen enzymes as is seen with inhibition of CCKA receptors, suggesting that while the CCKA and CCKB receptors comprise two structurally distinct families which bind different ligands and are primarily expressed in different tissues, they produce similar effects, and the distinction between their gastrointestinal and anxiolytic actions depends mainly on where they are expressed in the body.
The 21st century saw the company return to independence when it was purchased from Diageo by a group of investment firms led by TPG Capital for US$1.5 billion in 2002. The new owners rapidly moved to revitalize and reorganize the company, culminating with the company being taken public in 2006 with a highly successful initial public offering. The firms' strategy for turning the chain around included a new advertising agency and new ad campaigns, a revamped menu strategy, a series of programs designed to revamp individual stores, a new restaurant concept called the BK Whopper Bar, and a new design format called 20/20. These changes successfully re-energized the company, leading to a score of profitable quarters. New owners failed to stop the Great Recession from weakening the company's outlook, even as competitor McDonald's grew. The falling value of Burger King eventually led to TPG and its partners divesting their interest in the chain in a US$3.26 billion sale to 3G Capital of Brazil. Analysts from financial firms UBS and Stifel Nicolaus agreed that 3G would have to invest heavily in the company to help reverse its fortunes. After the deal was completed, the company's stock was removed from the New York Stock Exchange, ending four years as a public company. The delisting of its stock was designed to help the company repair its fundamental business structures and continue working to close the gap with McDonald's without having to worry about pleasing shareholders.
Sources: en.wikipedia.org
No. Thymosin beta-4 is a 43-residue protein, while TB-500 refers to a seven-residue fragment corresponding to its N-terminal region. The two names are often used loosely in commercial and community writing, which obscures the difference in size, sequence, and likely behavior.
The fragment contains an actin-binding motif, and cell-free experiments show that it can interact with monomeric actin. That observation is the basis for interest in cell migration and repair processes. Effects reported in animals are not established for humans.
Purity is usually stated by the supplier rather than fixed by a pharmacopoeial monograph, and typical listings report a percentage from reverse-phase HPLC. Independent verification is uncommon. Because no single accepted specification exists, comparisons between lots and between suppliers are difficult.
No. TB-500 is a trade-style label used for a synthetic peptide described as a fragment of thymosin beta-4, while thymosin beta-4 is the full 43-residue protein. The two differ in size and are not interchangeable terms in analytical work.